Journal: Drug Design, Development and Therapy

Article Title: Semaglutide Alleviates Ovary Inflammation via the AMPK/SIRT1/NF‑κB Signaling Pathway in Polycystic Ovary Syndrome Mice

doi: 10.2147/dddt.s484531

Figure Lengend Snippet: Figure 1 (A) Experimental flow chart; (B–D) Three weeks after modeling, PCOS mice were treated with semaglutide for 4 weeks. (B) Body weight; (C) Fasting glucose; (D) IPGTT and AUC. Data are presented as mean ± SD. Vs NC, ##P <0.01; vs PCOS, **P <0.01; n = 6 per group.

Article Snippet: After blocking with skimmed milk at room temperature for 2 hours the membranes were incubated overnight at 4°C with primary antibodies against AMPK (dilution 1:1000; No. 5831S, CST, USA), pAMPK (dilution 1:1000; No. 2535S, CST, USA), SIRT1 (dilution 1:1000; No. 8469S, CST, USA), NF-κB (dilution 1:1000; No. BA0610, BOSTER, China), IκBα (dilution 1:1000; No. 4812S, CST, USA), pIκBα (dilution 1:1000; No. 2859S, CST, USA), IL-1β (dilution 1:1000; No. 516288, ZEN-BIOSCIENCE, China), and IL-6 (dilution 1:1000; No. BA4339, BOSTER, China), TNF-α (dilution 1:1000; No. BA0103, BOSTER, China).

Techniques:

Journal: Drug Design, Development and Therapy

Article Title: Semaglutide Alleviates Ovary Inflammation via the AMPK/SIRT1/NF‑κB Signaling Pathway in Polycystic Ovary Syndrome Mice

doi: 10.2147/dddt.s484531

Figure Lengend Snippet: Figure 4 (A) Immunohistochemical images of IL-1β, IL-6, TNF-α, and NF-κB; Mean density: (B) IL-1β; (C) IL-6; (D) TNF-α; (E) NF-κB; (F) Western blot of IL-1β, IL-6, and TNF-α expression; (G) Peripheral blood IL-1β content. Data are presented as mean ± SD. Vs NC, ##P <0.01; Vs PCOS, *P <0.05, **P <0.01; n = 6 per group.

Article Snippet: After blocking with skimmed milk at room temperature for 2 hours the membranes were incubated overnight at 4°C with primary antibodies against AMPK (dilution 1:1000; No. 5831S, CST, USA), pAMPK (dilution 1:1000; No. 2535S, CST, USA), SIRT1 (dilution 1:1000; No. 8469S, CST, USA), NF-κB (dilution 1:1000; No. BA0610, BOSTER, China), IκBα (dilution 1:1000; No. 4812S, CST, USA), pIκBα (dilution 1:1000; No. 2859S, CST, USA), IL-1β (dilution 1:1000; No. 516288, ZEN-BIOSCIENCE, China), and IL-6 (dilution 1:1000; No. BA4339, BOSTER, China), TNF-α (dilution 1:1000; No. BA0103, BOSTER, China).

Techniques: Immunohistochemical staining, Western Blot, Expressing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification

Journal: Renal Failure

Article Title: Magnesium hydride protects against acetaminophen-induced acute kidney injury by inhibiting TXNIP/NLRP3/nf-κb pathway

doi: 10.1080/0886022X.2024.2330629

Figure Lengend Snippet: MgH 2 improves APAP-induced inflammation and apoptosis in kidneys of mice. (A, B) The mRNA expressions of TNF-α and IL-1β in kidneys of mice were detected by RT-qPCR. (C, D) The protein expressions of TNF-α, IL-1β, Bad, Bax, Caspase3 and CytC in kidneys of mice were detected by western blotting. (E) Tubular cell apoptosis in kidneys of mice was observed by TUNEL staining. The results were expressed as mean ± SEM. Statistical comparisons were performed using a Newman–Keuls test (* p < 0.05 vs. Control group, # p < 0.05 vs. APAP group).

Article Snippet: After blocking in 5% bovine serum for 2 h, the membranes were incubated at 4 °C overnight with primary antibodies against neutrophil gelatinase-associated lipocalin (NGAL; 1:1000, Cloud-Clone, China), kidney injury molecule-1 (KIM-1; 1:1000, Cloud-Clone, China), inducible nitric oxide synthase (iNOS; 1:1000, Cell Signaling Technology, USA), tumor necrosis factor-α (TNF-α; 1:1000, Servicebio, China), interleukin-1β (IL-1β; 1:1000, Cloud-Clone, China), Bcl2-antagonist of cell death (Bad; 1:1000, Cloud-Clone, China), Bcl2 associated X protein (Bax; 1:1000, Cell Signaling Technology, USA), Caspase3 (1:1000, Proteintech, USA), cytochrome C (CytC; 1:1000, Cell Signaling Technology, USA), TXNIP (1:1000), NLRP3 (1:1000, Cell Signaling Technology, USA), NF-κB p65 (1:1000, Cell Signaling Technology, USA), p-NF-κB p65 (1:1000), β-Actin (1:1000, Cell Signaling Technology, USA), β-Tubulin (1:1000, Abways, China) and GAPDH (1:1000, Servicebio, China).

Techniques: Quantitative RT-PCR, Western Blot, TUNEL Assay, Staining

Journal: Renal Failure

Article Title: Magnesium hydride protects against acetaminophen-induced acute kidney injury by inhibiting TXNIP/NLRP3/nf-κb pathway

doi: 10.1080/0886022X.2024.2330629

Figure Lengend Snippet: MgH 2 alleviates APAP-induced cytotoxicity, oxidative stress, mitochondrial dysfunction and inflammation in HK-2 cells. (A-C) HK-2 Cell viability was detected by CCK-8 assay. (A) HK-2 cells was administered with different concentrations of MgH 2 (10, 20, 50, 100, 200, 400, 600, 800 and 1000 μM); (B) HK-2 cells was administered with different concentrations of APAP (5, 10, 20, 40, 60, 80, 100 mM) with or without MgH 2 (0.4 mM); (C) HK-2 cells was administered with APAP (10 mM) with or without MgH 2 (0.2, 0.4 mM). (D) The ROS level in HK-2 cells was determined by DCFH-DA. (E) The mitochondrial function of HK-2 cells was assessed by JC-1 staining. (F, G) The protein expressions of iNOS, KIM-1 and IL-1β in HK-2 cells were detected by western blotting. The results were expressed as mean ± SEM. Statistical comparisons were performed using t -test (* p < 0.05 vs. APAP group) or Newman–Keuls test (* p < 0.05 vs. Control group, # p < 0.05 vs. APAP group).

Article Snippet: After blocking in 5% bovine serum for 2 h, the membranes were incubated at 4 °C overnight with primary antibodies against neutrophil gelatinase-associated lipocalin (NGAL; 1:1000, Cloud-Clone, China), kidney injury molecule-1 (KIM-1; 1:1000, Cloud-Clone, China), inducible nitric oxide synthase (iNOS; 1:1000, Cell Signaling Technology, USA), tumor necrosis factor-α (TNF-α; 1:1000, Servicebio, China), interleukin-1β (IL-1β; 1:1000, Cloud-Clone, China), Bcl2-antagonist of cell death (Bad; 1:1000, Cloud-Clone, China), Bcl2 associated X protein (Bax; 1:1000, Cell Signaling Technology, USA), Caspase3 (1:1000, Proteintech, USA), cytochrome C (CytC; 1:1000, Cell Signaling Technology, USA), TXNIP (1:1000), NLRP3 (1:1000, Cell Signaling Technology, USA), NF-κB p65 (1:1000, Cell Signaling Technology, USA), p-NF-κB p65 (1:1000), β-Actin (1:1000, Cell Signaling Technology, USA), β-Tubulin (1:1000, Abways, China) and GAPDH (1:1000, Servicebio, China).

Techniques: CCK-8 Assay, Staining, Western Blot